diff --git a/.gitignore b/.gitignore
index ea0d1853..5b175045 100644
--- a/.gitignore
+++ b/.gitignore
@@ -2,3 +2,4 @@
 *.swp
 .DS_Store
 tmp
+*~
\ No newline at end of file
diff --git a/README.md b/README.md
index f18d638c..2c32c6c8 100644
--- a/README.md
+++ b/README.md
@@ -1,6 +1,11 @@
 # xErlang
 
-Exercism exercises in Erlang
+Exercism exercises in Erlang.
+
+For each test there is a directory, which contains two files, e.g., in the `bob` dir
+there is `bob_test.erl` and `example.erl`. The example file define a module with the
+name `bob`, so that we can use it to check that the tests are running as they should.
+The users of exercism will create their own `bob.erl` file and `bob_test` will test it.
 
 ## Contributing Guide
 
diff --git a/_test/check-exercises.escript b/_test/check-exercises.escript
new file mode 100755
index 00000000..60dddf6b
--- /dev/null
+++ b/_test/check-exercises.escript
@@ -0,0 +1,34 @@
+#! /usr/bin/env escript
+
+main( [] ) -> 
+	Examples = filelib:wildcard( "*/example.erl" ),
+	Modules = [{X, compile(X)} || X <- Examples],
+	[compile_tests(X) || X <- Modules],
+	Results = [run_tests(X) || X <- Modules],
+	erlang:halt( erlang:length([X || X <- Results, X =:= ok]) );
+main( _ ) -> usage().
+
+
+
+compile( File ) ->
+	Compile = compile:file( File, [binary, return_errors] ),
+	{compile, File, {ok, Module, Binary}} = {compile, File, Compile},
+	Load = code:load_binary( Module, File, Binary ),
+	{load, Module, Load} = {load, Module, Load},
+	{Module, Binary}.
+
+
+compile_tests( {Example, {Example_module, _Binary}} ) ->
+	Filename = erlang:atom_to_list(Example_module) ++ "_tests.erl",
+	Filepath = filename:join( [filename:dirname(Example), Filename] ),
+	compile( Filepath ).
+
+
+run_tests( {_Example, {Module, _Binary}} ) ->
+	io:fwrite( "~p: ", [Module] ),
+	eunit:test( Module ).
+
+
+usage() ->
+	io:fwrite( "Usage: ~s~n", [escript:script_name()] ),
+	io:fwrite( "~s will compile and run Erlang examples and test cases in sub directories of where it is started.~n", [escript:script_name()] ).
diff --git a/accumulate/accumulate_tests.erl b/accumulate/accumulate_tests.erl
new file mode 100644
index 00000000..96564135
--- /dev/null
+++ b/accumulate/accumulate_tests.erl
@@ -0,0 +1,25 @@
+-module( accumulate_tests ).
+
+-include_lib("eunit/include/eunit.hrl").
+
+accumulate_squares_test() ->
+  Fn = fun(Number) -> Number * Number end,
+  Ls = [1, 2, 3],
+  ?assertEqual([1, 4, 9], accumulate:accumulate(Fn, Ls)).
+
+accumulate_upcases_test() ->
+  Fn = fun(Word) -> string:to_upper(Word) end,
+  Ls = string:tokens("hello world", " "),
+  ?assertEqual(["HELLO", "WORLD"], accumulate:accumulate(Fn, Ls)).
+
+accumulate_reversed_strings_test() ->
+  Fn = fun(Word) -> lists:reverse(Word) end,
+  Ls = string:tokens("the quick brown fox etc", " "),
+  ?assertEqual(["eht", "kciuq", "nworb", "xof", "cte"], accumulate:accumulate(Fn, Ls)).
+
+accumulate_recursively_test() ->
+  Chars = string:tokens("a b c", " "),
+  Nums  = string:tokens("1 2 3", " "),
+  Fn    = fun(Char) -> [Char ++ Num || Num <- Nums] end,
+  ?assertEqual([["a1", "a2", "a3"], ["b1", "b2", "b3"], ["c1", "c2", "c3"]], accumulate:accumulate(Fn, Chars)).
+
diff --git a/allergies/allergies_test.erl b/allergies/allergies_test.erl
new file mode 100644
index 00000000..23b7d579
--- /dev/null
+++ b/allergies/allergies_test.erl
@@ -0,0 +1,49 @@
+% To run tests:
+% elc *.erl
+% erl -noshell -eval "eunit:test(allergies, [verbose])" -s init stop
+%
+
+-module(allergies_test).
+
+-include_lib("eunit/include/eunit.hrl").
+
+no_allergies_at_all_test() ->
+    ?assertEqual(allergies:allergies(0), []).
+
+allergic_to_just_eggs_test() ->
+    ?assertEqual(allergies:allergies(1), ['eggs']).
+
+allergic_to_just_peanuts_test() ->
+    ?assertEqual(allergies:allergies(2), ['peanuts']).
+
+allergic_to_just_strawberries_test() ->
+    ?assertEqual(allergies:allergies(8), ['strawberries']).
+
+allergic_to_eggs_and_peanuts_test() ->
+    ?assertEqual(allergies:allergies(3), ['eggs', 'peanuts']).
+
+allergic_to_more_than_eggs_but_not_peanuts_test() ->
+    ?assertEqual(allergies:allergies(5), ['eggs', 'shellfish']).
+
+allergic_to_lots_of_stuff_test() ->
+    ?assertEqual(allergies:allergies(248), ['strawberries', 'tomatoes', 'chocolate',
+                                            'pollen', 'cats']).
+
+allergic_to_everything_test() ->
+    ?assertEqual(allergies:allergies(255),['eggs', 'peanuts', 'shellfish', 'strawberries',
+                                           'tomatoes', 'chocolate', 'pollen', 'cats']).
+
+no_allergies_means_not_allergic_test() ->
+    ?assertNot(allergies:isAllergicTo('peanuts', 0)),
+    ?assertNot(allergies:isAllergicTo('cats', 0)),
+    ?assertNot(allergies:isAllergicTo('strawberries', 0)).
+
+is_allergic_to_eggs_test() ->
+    ?assert(allergies:isAllergicTo('eggs', 1)).
+
+allergic_to_eggs_and_other_stuff_test() ->
+    ?assert(allergies:isAllergicTo('eggs', 5)).
+
+ignore_non_allergen_score_parts_test() ->
+    ?assertEqual(allergies:allergies(509), ['eggs', 'shellfish', 'strawberries',
+                                            'tomatoes', 'chocolate', 'pollen', 'cats']).
diff --git a/allergies/allergies_tests.erl b/allergies/allergies_tests.erl
index 1ddcaeb9..1af49fb9 100644
--- a/allergies/allergies_tests.erl
+++ b/allergies/allergies_tests.erl
@@ -3,7 +3,7 @@
 % erl -noshell -eval "eunit:test(allergies, [verbose])" -s init stop
 %
 
--module(allergies_tests).
+-module( allergies_tests ).
 
 -include_lib("eunit/include/eunit.hrl").
 
diff --git a/anagram/anagram_tests.erl b/anagram/anagram_tests.erl
new file mode 100644
index 00000000..8d0def08
--- /dev/null
+++ b/anagram/anagram_tests.erl
@@ -0,0 +1,48 @@
+-module( anagram_tests ).
+-include_lib("eunit/include/eunit.hrl").
+
+no_matches_test() ->
+    ?assertEqual(
+       anagram:find("diaper", ["hello", "world", "zombies", "pants"]),
+       []).
+
+detect_simple_anagram_test() ->
+    ?assertEqual(
+       anagram:find("ant", ["tan", "stand", "at"]),
+       ["tan"]).
+
+does_not_confuse_different_duplicates_test() ->
+    ?assertEqual(
+       anagram:find("galea", ["eagle"]),
+       []).
+
+eliminate_anagram_subsets_test() ->
+    ?assertEqual(
+       anagram:find("good", ["dog", "goody"]),
+       []).
+
+detect_anagram_test() ->
+    ?assertEqual(
+       anagram:find("listen", ["enlists", "google", "inlets", "banana"]),
+       ["inlets"]).
+
+multiple_anagrams_test() ->
+    ?assertEqual(
+       anagram:find("allergy", ["gallery", "ballerina", "regally", "clergy",
+                                "largely", "leading"]),
+       ["gallery", "regally", "largely"]).
+
+case_insensitive_subject_test() ->
+    ?assertEqual(
+       anagram:find("Orchestra", ["cashregister", "carthorse", "radishes"]),
+       ["carthorse"]).
+
+case_insensitive_candidate_test() ->
+    ?assertEqual(
+       anagram:find("orchestra", ["cashregister", "Carthorse", "radishes"]),
+       ["Carthorse"]).
+
+does_not_detect_a_word_as_its_own_anagram_test() ->
+    ?assertEqual(
+       anagram:find("corn", ["corn", "dark", "Corn", "rank", "CORN", "cron", "park"]),
+       ["cron"]).
diff --git a/bank-account/bank_account_tests.erl b/bank-account/bank_account_tests.erl
new file mode 100644
index 00000000..ed84ce0f
--- /dev/null
+++ b/bank-account/bank_account_tests.erl
@@ -0,0 +1,95 @@
+-module(bank_account_tests).
+-include_lib("eunit/include/eunit.hrl").
+
+
+create_test() ->
+	      Bank_account = bank_account:create(),
+	      ?assert(bank_account:balance( Bank_account ) =:= 0).
+
+close_account_test() ->
+              Bank_account = bank_account:create(),
+              bank_account:deposit( Bank_account, 1 ),
+              Amount = bank_account:close( Bank_account ),
+              ?assert(Amount =:= 1),
+	      ?assertError(function_clause, bank_account:balance( Bank_account )).
+
+deposit_test() ->
+	       Bank_account = bank_account:create(),
+	       bank_account:deposit( Bank_account, 1 ),
+	       ?assert(bank_account:balance( Bank_account ) =:= 1).
+
+deposit_fail_test() ->
+	       Bank_account = bank_account:create(),
+	       bank_account:deposit( Bank_account, -1 ),
+	       ?assert(bank_account:balance( Bank_account ) =:= 0).
+
+deposit_many_test() ->
+               Bank_account = bank_account:create(),
+	       [erlang:spawn( fun () -> bank_account:deposit(Bank_account, X) end ) || X <- lists:seq(1, 10)],
+	       First = bank_account:balance( Bank_account ),
+	       timer:sleep( 100 ),
+	       Last = bank_account:balance( Bank_account ),
+              ?assert(First < 55),
+              ?assert(Last =:= 55).
+
+withdraw_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+               Amount = bank_account:withdraw( Bank_account, 1 ),
+              ?assert(Amount =:= 1),
+              ?assert(bank_account:balance( Bank_account ) =:= 9).
+
+withdraw_fail_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+	       Amount = bank_account:withdraw( Bank_account, -1 ),
+              ?assert(Amount =:= 0),
+              ?assert(bank_account:balance( Bank_account ) =:= 10).
+
+withdraw_excessive_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+	       Amount = bank_account:withdraw( Bank_account, 20 ),
+              ?assert(Amount =:= 10),
+              ?assert(bank_account:balance( Bank_account ) =:= 0).
+
+withdraw_many_test() ->
+               Bank_account = bank_account:create(),
+	       bank_account:deposit(Bank_account, 55 ),
+	       [erlang:spawn( fun () -> bank_account:withdraw(Bank_account, X) end ) || X <- lists:seq(1, 10)],
+	       First = bank_account:balance( Bank_account ),
+	       timer:sleep( 100 ),
+	       Last = bank_account:balance( Bank_account ),
+              ?assert(First > 0),
+              ?assert(Last =:= 0).
+
+charge_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+	       Amount = bank_account:charge( Bank_account, 2 ),
+              ?assert(Amount =:= 2),
+              ?assert(bank_account:balance( Bank_account ) =:= 8).
+
+charge_fail_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+	       Amount = bank_account:charge( Bank_account, -2 ),
+              ?assert(Amount =:= 0),
+              ?assert(bank_account:balance( Bank_account ) =:= 10).
+
+charge_excessive_test() ->
+               Bank_account = bank_account:create(),
+               bank_account:deposit( Bank_account, 10 ),
+	       Amount = bank_account:charge( Bank_account, 20 ),
+              ?assert(Amount =:= 0),
+              ?assert(bank_account:balance( Bank_account ) =:= 10).
+
+charge_many_test() ->
+               Bank_account = bank_account:create(),
+	       bank_account:deposit(Bank_account, 55 ),
+	       [erlang:spawn( fun () -> bank_account:charge(Bank_account, 10) end ) || _X <- lists:seq(1, 10)],
+	       First = bank_account:balance( Bank_account ),
+	       timer:sleep( 100 ),
+	       Last = bank_account:balance( Bank_account ),
+              ?assert(First > 0),
+              ?assert(Last =:= 5).
diff --git a/bank-account/example.erl b/bank-account/example.erl
new file mode 100644
index 00000000..97b7e9fb
--- /dev/null
+++ b/bank-account/example.erl
@@ -0,0 +1,48 @@
+-module(bank_account).
+
+-export( [balance/1, charge/2, close/1, create/0, deposit/2, withdraw/2] ).
+
+balance( Pid ) -> call( erlang:is_process_alive(Pid), Pid, balance, 0 ).
+
+charge( Pid, Amount ) when Amount > 0 -> call( erlang:is_process_alive(Pid), Pid, charge, Amount );
+charge( _Pid, _Amount ) -> 0.
+
+close( Pid ) -> call( erlang:is_process_alive(Pid), Pid, close, 0 ).
+
+create() -> erlang:spawn( fun () -> loop(0) end ).
+
+deposit( Pid, Amount ) when Amount > 0 -> Pid ! {deposit, Amount};
+deposit( _Pid, _Amount ) -> ok.
+
+withdraw( Pid, Amount ) when Amount > 0 -> call( erlang:is_process_alive(Pid), Pid, withdraw, Amount );
+withdraw( _Pid, _Amount ) -> 0.
+
+
+
+call( true, Pid, Request, Argument ) ->
+      Pid ! {Request, Argument, erlang:self()},
+      receive
+      {Request, Answer} -> Answer
+      end.
+
+loop( Balance ) ->
+      receive
+      {balance, _Argument, Pid} ->
+      		Pid ! {balance, Balance},
+		loop( Balance );
+      {charge, Amount, Pid} ->
+      	       Charge = loop_charge( Balance, Amount ),
+       	      Pid ! {charge, Charge},
+	      loop( Balance - Charge );
+      {close, _Argument, Pid} ->
+      		Pid ! {close, Balance};
+      {deposit, Amount} ->
+      		loop( Balance + Amount );
+      {withdraw, Amount, Pid} ->
+      		Withdraw = erlang:min( Balance, Amount ),
+      		Pid ! {withdraw, Withdraw},
+		loop( Balance - Withdraw )
+      end.
+
+loop_charge( Balance, Amount ) when Balance >= Amount -> Amount;
+loop_charge( _Balance, _Amount ) -> 0.
diff --git a/beer-song/beer_song_tests.erl b/beer-song/beer_song_tests.erl
new file mode 100644
index 00000000..3ad89214
--- /dev/null
+++ b/beer-song/beer_song_tests.erl
@@ -0,0 +1,50 @@
+-module( beer_song_tests ).
+-include_lib("eunit/include/eunit.hrl").
+
+verse_test() ->
+  compareNestedLists(beer_song:verse(8),
+    "8 bottles of beer on the wall, 8 bottles of beer.\n"
+    "Take it down and pass it around, 7 bottles of beer on the wall.\n").
+
+verse_0_test() ->
+  compareNestedLists(beer_song:verse(0),
+    "No more bottles of beer on the wall, no more bottles of beer.\n"
+    "Go to the store and buy some more, 99 bottles of beer on the wall.\n").
+
+verse_1_test() ->
+  compareNestedLists(beer_song:verse(1),
+     "1 bottle of beer on the wall, 1 bottle of beer.\n"
+     "Take it down and pass it around, no more bottles of beer on the wall.\n").
+
+verse_2_test() ->
+  compareNestedLists(beer_song:verse(2),
+    "2 bottles of beer on the wall, 2 bottles of beer.\n"
+    "Take it down and pass it around, 1 bottle of beer on the wall.\n").
+
+singing_several_verses_test() ->
+  compareNestedLists(beer_song:sing(8, 6),
+    "8 bottles of beer on the wall, 8 bottles of beer.\n"
+    "Take it down and pass it around, 7 bottles of beer on the wall.\n\n"
+
+    "7 bottles of beer on the wall, 7 bottles of beer.\n"
+    "Take it down and pass it around, 6 bottles of beer on the wall.\n\n"
+
+    "6 bottles of beer on the wall, 6 bottles of beer.\n"
+    "Take it down and pass it around, 5 bottles of beer on the wall.\n\n").
+
+sing_all_the_rest_of_the_verses_test() ->
+  compareNestedLists(beer_song:sing(3),
+    "3 bottles of beer on the wall, 3 bottles of beer.\n"
+    "Take it down and pass it around, 2 bottles of beer on the wall.\n\n"
+
+    "2 bottles of beer on the wall, 2 bottles of beer.\n"
+    "Take it down and pass it around, 1 bottle of beer on the wall.\n\n"
+
+    "1 bottle of beer on the wall, 1 bottle of beer.\n"
+    "Take it down and pass it around, no more bottles of beer on the wall.\n\n"
+
+    "No more bottles of beer on the wall, no more bottles of beer.\n"
+    "Go to the store and buy some more, 99 bottles of beer on the wall.\n\n").
+
+compareNestedLists(Response, Expected) ->
+  ?assertEqual(lists:flatten(Response), lists:flatten(Expected)).
diff --git a/bin/configlet-darwin-386 b/bin/configlet-darwin-386
new file mode 100755
index 00000000..514ec094
Binary files /dev/null and b/bin/configlet-darwin-386 differ
diff --git a/bin/configlet-darwin-amd64 b/bin/configlet-darwin-amd64
new file mode 100755
index 00000000..1142a8c7
Binary files /dev/null and b/bin/configlet-darwin-amd64 differ
diff --git a/bin/configlet-linux-386 b/bin/configlet-linux-386
new file mode 100755
index 00000000..2ff44037
Binary files /dev/null and b/bin/configlet-linux-386 differ
diff --git a/bin/configlet-linux-amd64 b/bin/configlet-linux-amd64
new file mode 100755
index 00000000..45ec32d5
Binary files /dev/null and b/bin/configlet-linux-amd64 differ
diff --git a/bin/configlet-windows-386.exe b/bin/configlet-windows-386.exe
new file mode 100755
index 00000000..64f20caf
Binary files /dev/null and b/bin/configlet-windows-386.exe differ
diff --git a/bin/configlet-windows-amd64.exe b/bin/configlet-windows-amd64.exe
new file mode 100755
index 00000000..39fc7872
Binary files /dev/null and b/bin/configlet-windows-amd64.exe differ
diff --git a/binary/binary_string_tests.erl b/binary/binary_string_tests.erl
new file mode 100644
index 00000000..8648a3ac
--- /dev/null
+++ b/binary/binary_string_tests.erl
@@ -0,0 +1,22 @@
+-module( binary_string_tests ).
+-include_lib( "eunit/include/eunit.hrl" ).
+
+
+one_test() -> check( "1" ).
+
+two_test() -> check( "10" ).
+
+three_test() -> check( "11" ).
+
+four_test() ->	check( "100" ).
+
+nine_test() -> check( "1001" ).
+
+twenty_six_test() -> check( "11010" ).
+
+large_test() -> check( "10001101000" ).
+
+carrot_test() -> ?assert(0 =:= binary_string:to_decimal( "carrot" )).
+
+check( String ) ->
+       ?assert(binary_string:to_decimal( String ) =:= erlang:list_to_integer( String, 2 )).
diff --git a/binary/example.erl b/binary/example.erl
new file mode 100644
index 00000000..0c3225ec
--- /dev/null
+++ b/binary/example.erl
@@ -0,0 +1,17 @@
+-module( binary_string ). % binary is a "sticky module" so we have to use another name.
+-export( [to_decimal/1] ).
+
+to_decimal( String ) ->
+	    try
+	    {_N, Result} = lists:foldr( fun to_decimal/2, {0, 0}, String ),
+	    Result
+
+	    catch
+	    _:_ -> 0
+
+	    end.
+
+
+
+to_decimal( $0, {N, Acc} ) -> {N + 1, Acc};
+to_decimal( $1, {N, Acc} ) -> {N + 1, Acc + erlang:trunc(math:pow(2, N))}.
diff --git a/bob/bob_tests.erl b/bob/bob_tests.erl
new file mode 100644
index 00000000..6dbb9389
--- /dev/null
+++ b/bob/bob_tests.erl
@@ -0,0 +1,70 @@
+-module( bob_tests ).
+
+-include_lib("eunit/include/eunit.hrl").
+
+responds_to_something_test() ->
+    bob_responds("Tom-ay-to, tom-aaaah-to.", "Whatever.").
+
+responds_to_shouts_test() ->
+    bob_responds("WATCH OUT!", "Woah, chill out!").
+
+responds_to_questions_test() ->
+    bob_responds("Does this cryogenic chamber make me look fat?", "Sure.").
+
+responds_to_forceful_talking_test() ->
+    bob_responds("Let's go make out behind the gym!", "Whatever.").
+
+responds_to_acronyms_test() ->
+    bob_responds("It's OK if you don't want to go to the DMV.", "Whatever.").
+
+responds_to_forceful_questions_test() ->
+    bob_responds("WHAT THE HELL WERE YOU THINKING?", "Woah, chill out!").
+
+responds_to_shouting_with_special_characters_test() ->
+    bob_responds("ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!",
+                 "Woah, chill out!").
+
+responds_to_shouting_numbers_test() ->
+    bob_responds("1, 2, 3, GO!", "Woah, chill out!").
+
+responds_to_shouting_with_no_exclamation_mark_test() ->
+    bob_responds("I HATE YOU", "Woah, chill out!").
+
+responds_to_statement_containing_question_mark_test() ->
+    bob_responds("Ending with ? means a question", "Whatever.").
+
+responds_to_silence_test() ->
+    bob_responds("", "Fine. Be that way!").
+
+responds_to_prolonged_silence_test() ->
+    bob_responds("    ", "Fine. Be that way!").
+
+
+responds_to_non_letters_with_question_test() ->
+    bob_responds(":) ?", "Sure.").
+
+responds_to_multiple_line_questions_test() ->
+    bob_responds("\nDoes this cryogenic chamber make me look fat? \nno",
+                 "Whatever.").
+
+%% This one is especially challenging in Erlang, hint: use the re module.
+
+%%responds_to_other_whitespace_test() ->
+%%    bob_responds("\n\r \t\v\xA0\x{2002}",
+%%                 "Fine. Be that way!").
+
+responds_to_only_numbers_test() ->
+    bob_responds("1, 2, 3", "Whatever.").
+
+responds_to_question_with_only_numbers_test() ->
+    bob_responds("4?", "Sure.").
+
+responds_to_unicode_shout_test() ->
+    bob_responds("\xdcML\xc4\xdcTS!", "Woah, chill out!").
+
+responds_to_unicode_non_shout_test() ->
+    bob_responds("\xdcML\xe4\xdcTS!", "Whatever.").
+
+bob_responds(Question, Answer) ->
+    ?assertEqual(bob:response_for(Question),
+                  Answer).
diff --git a/config.json b/config.json
index b2dd685d..affa251f 100644
--- a/config.json
+++ b/config.json
@@ -4,7 +4,19 @@
   "repository": "https://github.com/exercism/xerlang",
   "active": false,
   "problems": [
-
+      "bob",
+      "word-count",
+      "accumulate",
+      "anagram",
+      "beer-song",
+      "nucleotide-count",
+      "rna-transcription",
+      "point-mutations",
+      "phone-number",
+      "etl",
+      "allergies",
+      "trinary",
+      "luhn"
   ],
   "deprecated": [
 
diff --git a/crypto-square/crypto_square_tests.erl b/crypto-square/crypto_square_tests.erl
new file mode 100644
index 00000000..542c69d4
--- /dev/null
+++ b/crypto-square/crypto_square_tests.erl
@@ -0,0 +1,19 @@
+-module( crypto_square_tests ).
+-include_lib( "eunit/include/eunit.hrl" ).
+
+encode1_test() -> ?assert( ["i"] =:= crypto_square:encode("I") ).
+
+encode2_test() -> ?assert( ["ima"] =:= crypto_square:encode("I am") ).
+
+encode_example1_test() ->
+	      Plain_text = "If man was meant to stay on the ground, God would have given us roots.",
+	      Cypher = ["imtgd","vsfea","rwerm","ayoog","oanou","uiont","nnlvt", "wttdd","esaoh","ghnss","eoau"],
+	      ?assert( Cypher =:= crypto_square:encode(Plain_text) ).
+
+encode_example2_test() ->
+			Plain_text = "Have a nice day. Feed the dog & chill out!",
+			Cypher1 = "hifei",
+			Cypher2 = "acedl",
+			Cypher = crypto_square:encode( Plain_text ),
+			?assert( Cypher1 =:= lists:nth(1, Cypher) ),
+			?assert( Cypher2 =:= lists:nth(2, Cypher) ).
diff --git a/crypto-square/example.erl b/crypto-square/example.erl
new file mode 100644
index 00000000..2cc17a0b
--- /dev/null
+++ b/crypto-square/example.erl
@@ -0,0 +1,33 @@
+-module( crypto_square ).
+
+-export( [encode/1] ).
+
+encode( String ) ->
+	Normalised = [X || X <- string:to_lower(String), is_letter(X)],
+	Length = erlang:length( Normalised ),
+	Square_root = math:sqrt( Length ),
+	Width = width( Square_root, erlang:trunc(Square_root) ),
+	Rows = rows( Length, Width, Normalised ),
+	Queue = queue:from_list( Rows ),
+	Transposed = first_in_each_row( queue:out(Queue) ),
+	rows( Length, 5, Transposed ).
+
+
+first_in_each_row( {empty, _Q} ) -> [];
+first_in_each_row( {{value, [Character | Row]}, Q} ) ->
+	   New_q = first_in_each_row_q( Row, Q ),
+	   [Character | first_in_each_row( queue:out(New_q) )].
+
+first_in_each_row_q( [], Q ) -> Q;
+first_in_each_row_q( Row, Q ) -> queue:in( Row, Q ).
+
+is_letter( C ) when C >= $a, C =< $z -> true;
+is_letter( _C ) -> false.
+
+rows( Length, Width, String ) when Length > Width ->
+	{Row, Rest} = lists:split( Width, String ),
+	[Row | rows( Length - Width, Width, Rest )];
+rows( _Length, _Width, String ) -> [String].
+
+width( Square_root, Trunc ) when Square_root > Trunc -> Trunc + 1;
+width( _Square_root, Trunc ) -> Trunc.
diff --git a/etl/etl_test.erl b/etl/etl_test.erl
index d69c894f..40c9eb23 100644
--- a/etl/etl_test.erl
+++ b/etl/etl_test.erl
@@ -51,6 +51,6 @@ transform_full_dataset_test() ->
   erl_transform(Old, Expected).
 
 erl_transform(Old,New) ->
-    ?assertEqual(example:transform(Old), New).
+    ?assertEqual(etl:transform(Old), New).
 
 
diff --git a/etl/etl_tests.erl b/etl/etl_tests.erl
new file mode 100644
index 00000000..f838b22a
--- /dev/null
+++ b/etl/etl_tests.erl
@@ -0,0 +1,56 @@
+-module( etl_tests ).
+
+-include_lib("eunit/include/eunit.hrl").
+
+transform_one_value_test() ->
+  erl_transform([{"a", [1]}], [{1, "a"}]).
+
+transform_one_word_test() ->
+  erl_transform([{"hello", ["WORLD"]}], [{"world", "hello"}]).    
+
+transform_more_values_test() ->
+    erl_transform([{"hello", ["WORLD","GSCHOOLERS"]}], [{"gschoolers", "hello"}, {"world", "hello"}]). 
+
+transform_multiple_keys_from_one_value_test() ->
+    erl_transform([{"a", [1]}, {"b", [1]}], [{1, "ab"}]).
+
+transform_multiple_keys_from_multiple_values_test() ->
+    erl_transform([{"a", [1]}, {"b", [4]}], [{1, "a"}, {4, "b"}]).
+
+transform_more_keys_test() ->
+  Old = [
+    {"a", ["APPLE", "ARTICHOKE"]}
+   ,{"b", ["BOAT", "BALLERINA"]}
+  ],
+  Expected = [
+      {"apple", "a"},
+      {"artichoke", "a"},
+      {"ballerina", "b"},
+      {"boat", "b"}
+  ],
+  erl_transform(Old, Expected).
+
+transform_full_dataset_test() ->
+  Old = [ 
+    {1,   ["A","E","I","O","U","L","N","R","S","T"]}
+  , {2,   ["D","G"]}
+  , {3,   ["B","C","M","P"]}
+  , {4,   ["F","H","V","W","Y"]}
+  , {5,   ["K"]}
+  , {8,   ["J","X"]}
+  , {10,  ["Q","Z"]}
+  ],
+  Expected = [ 
+    {"a", 1}, {"b", 3}, {"c", 3}, {"d", 2}, {"e", 1}
+  , {"f", 4}, {"g", 2}, {"h", 4}, {"i", 1}, {"j", 8}
+  , {"k", 5}, {"l", 1}, {"m", 3}, {"n", 1}, {"o", 1}
+  , {"p", 3}, {"q", 10}, {"r", 1}, {"s", 1}, {"t", 1}
+  , {"u", 1}, {"v", 4}, {"w", 4}, {"x", 8}, {"y", 4}
+  , {"z", 10} 
+  ],
+  erl_transform(Old, Expected).
+
+erl_transform(Old,New) ->
+    ?assertEqual(etl:transform(Old), New).
+
+
diff --git a/etl/example.erl b/etl/example.erl
index 9726652c..b8460288 100644
--- a/etl/example.erl
+++ b/etl/example.erl
@@ -1,4 +1,4 @@
--module(example).
+-module(etl).
 
 -export([transform/1]).
 
diff --git a/luhn/luhn_tests.erl b/luhn/luhn_tests.erl
new file mode 100644
index 00000000..9520b715
--- /dev/null
+++ b/luhn/luhn_tests.erl
@@ -0,0 +1,14 @@
+-module( luhn_tests ).
+-include_lib("eunit/include/eunit.hrl").
+
+invalid_test() ->
+  ?assertNot(luhn:valid("1111")),
+  ?assertNot(luhn:valid("738")).
+
+valid_test() ->
+  ?assert(luhn:valid("8739567")),
+  ?assert(luhn:valid("8763")),
+  ?assert(luhn:valid("2323 2005 7766 3554")).
+
+create_test() ->
+  ?assertEqual("2323 2005 7766 3554", luhn:create("2323 2005 7766 355")).
diff --git a/nucleotide-count/dna_test.erl b/nucleotide-count/dna_test.erl
new file mode 100644
index 00000000..c4f39370
--- /dev/null
+++ b/nucleotide-count/dna_test.erl
@@ -0,0 +1,30 @@
+-module(dna_test).
+
+-include_lib("eunit/include/eunit.hrl").
+
+empty_dna_string_has_no_adenosine_test() ->
+    ?assertEqual(dna:count("", "A"), 0).
+
+repetitive_cytidine_gets_counted_test() ->
+    ?assertEqual(dna:count("CCCCC", "C"), 5).
+
+counts_only_thymidine_test() ->
+    ?assertEqual(dna:count("GGGGGTAACCCGG", "T"), 1).
+
+dna_has_no_uracil_test() ->
+    ?assertEqual(dna:count("GATTACA", "U"), 0).
+
+validates_nucleotides_test() ->
+    ?assertException(error, "Invalid nucleotide", dna:count("GACT", "X")).
+
+empty_dna_string_has_no_nucleotides_test() ->
+    ?assertEqual(dna:nucleotide_counts(""),
+                 [{"A", 0}, {"T", 0}, {"C", 0}, {"G", 0}]).
+
+repetitive_sequence_has_only_guanosine_test() ->
+    ?assertEqual(dna:nucleotide_counts("GGGGGGGG"),
+                 [{"A", 0}, {"T", 0}, {"C", 0}, {"G", 8}]).
+
+counts_all_nucleotides_test() ->
+    ?assertEqual(dna:nucleotide_counts("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"),
+                 [{"A", 20}, {"T", 21}, {"C", 12}, {"G", 17}]).
diff --git a/nucleotide-count/dna_tests.erl b/nucleotide-count/dna_tests.erl
index e6273ba9..90e03aaa 100644
--- a/nucleotide-count/dna_tests.erl
+++ b/nucleotide-count/dna_tests.erl
@@ -1,4 +1,4 @@
--module(dna_tests).
+-module( dna_tests ).
 
 -include_lib("eunit/include/eunit.hrl").
 
diff --git a/phone-number/phone_test.erl b/phone-number/phone_test.erl
new file mode 100644
index 00000000..4dbb49aa
--- /dev/null
+++ b/phone-number/phone_test.erl
@@ -0,0 +1,29 @@
+% To run tests:
+% elc *.erl
+% erl -noshell -eval "eunit:test(phone, [verbose])" -s init stop
+%
+-module(phone_test).
+
+-include_lib("eunit/include/eunit.hrl").
+
+cleans_number_test() ->
+    ?assertEqual(phone:number("(123) 456-7890"), "1234567890").
+
+cleans_number_with_dots_test() ->
+    ?assertEqual(phone:number("123.456.7890"), "1234567890").
+
+valid_when_eleven_digits_test() ->
+    ?assertEqual(phone:number("11234567890"), "1234567890").
+
+invalid_when_eleven_digits_test() ->
+    ?assertEqual(phone:number("21234567890"), "0000000000").
+
+invalid_when_nine_digits_test() ->
+    ?assertEqual(phone:number("123456789"), "0000000000").
+
+area_code_test() ->
+    ?assertEqual(phone:areacode("1234567890"), "123").
+
+pretty_print_test() ->
+    ?assertEqual(phone:pretty_print("1234567890"),  "(123) 456-7890"),
+    ?assertEqual(phone:pretty_print("11234567890"), "(123) 456-7890").
diff --git a/phone-number/phone_tests.erl b/phone-number/phone_tests.erl
index 3e7d9212..31d51fcf 100644
--- a/phone-number/phone_tests.erl
+++ b/phone-number/phone_tests.erl
@@ -2,7 +2,7 @@
 % elc *.erl
 % erl -noshell -eval "eunit:test(phone, [verbose])" -s init stop
 %
--module(phone_tests).
+-module( phone_tests ).
 
 -include_lib("eunit/include/eunit.hrl").
 
diff --git a/point-mutations/dna.erl b/point-mutations/dna.erl
deleted file mode 100644
index 57c5efe7..00000000
--- a/point-mutations/dna.erl
+++ /dev/null
@@ -1,6 +0,0 @@
--module(dna).
-
--export([hammingDistance/2]).
-
-hammingDistance(_, _) ->
-    0.
diff --git a/point-mutations/dna_test.erl b/point-mutations/dna_test.erl
new file mode 100644
index 00000000..7d9d8362
--- /dev/null
+++ b/point-mutations/dna_test.erl
@@ -0,0 +1,26 @@
+-module(dna_test).
+
+-include_lib("eunit/include/eunit.hrl").
+
+
+no_difference_between_empty_strands_test() ->
+  ?assertEqual(0, dna:hamming_distance("", "")).
+
+no_difference_between_identical_strands_test() ->
+  ?assertEqual(0, dna:hamming_distance("GGACTGA", "GGACTGA")).
+
+hamming_distance_in_off_by_one_strand_test() ->
+  ?assertEqual(19, dna:hamming_distance("GGACGGATTCTGACCTGGACTAATTTTGGGG",
+                                        "AGGACGGATTCTGACCTGGACTAATTTTGGGG")).
+
+small_hamming_distance_in_middle_somewhere_test() ->
+  ?assertEqual(1, dna:hamming_distance("GGACG", "GGTCG")).
+
+langer_distance_test() ->
+  ?assertEqual(2 , dna:hamming_distance("ACCAGGG", "ACTATGG")).
+
+ignores_extra_length_on_other_strand_when_longer_test()->
+  ?assertEqual(3, dna:hamming_distance("AAACTAGGGG", "AGGCTAGCGGTAGGAC")).
+
+ignores_extra_length_on_original_strand_when_longer_test() ->
+  ?assertEqual(5, dna:hamming_distance("GACTACGGACAGGGTAGGGAAT", "GACATCGCACACC")).
diff --git a/point-mutations/dna_tests.erl b/point-mutations/dna_tests.erl
index c8133d33..5eb8dccf 100644
--- a/point-mutations/dna_tests.erl
+++ b/point-mutations/dna_tests.erl
@@ -1,3 +1,26 @@
--module(dna_tests).
+-module( dna_tests ).
 
 -include_lib("eunit/include/eunit.hrl").
+
+
+no_difference_between_empty_strands_test() ->
+  ?assertEqual(0, dna:hamming_distance("", "")).
+
+no_difference_between_identical_strands_test() ->
+  ?assertEqual(0, dna:hamming_distance("GGACTGA", "GGACTGA")).
+
+hamming_distance_in_off_by_one_strand_test() ->
+  ?assertEqual(19, dna:hamming_distance("GGACGGATTCTGACCTGGACTAATTTTGGGG",
+                                        "AGGACGGATTCTGACCTGGACTAATTTTGGGG")).
+
+small_hamming_distance_in_middle_somewhere_test() ->
+  ?assertEqual(1, dna:hamming_distance("GGACG", "GGTCG")).
+
+langer_distance_test() ->
+  ?assertEqual(2 , dna:hamming_distance("ACCAGGG", "ACTATGG")).
+
+ignores_extra_length_on_other_strand_when_longer_test()->
+  ?assertEqual(3, dna:hamming_distance("AAACTAGGGG", "AGGCTAGCGGTAGGAC")).
+
+ignores_extra_length_on_original_strand_when_longer_test() ->
+  ?assertEqual(5, dna:hamming_distance("GACTACGGACAGGGTAGGGAAT", "GACATCGCACACC")).
diff --git a/point-mutations/example.erl b/point-mutations/example.erl
new file mode 100644
index 00000000..40bbf618
--- /dev/null
+++ b/point-mutations/example.erl
@@ -0,0 +1,12 @@
+-module(dna).
+
+-export([hamming_distance/2]).
+
+hamming_distance([], _) ->
+  0;
+hamming_distance(_, []) ->
+  0;
+hamming_distance([A|As], [A|Bs]) ->
+  hamming_distance(As, Bs);
+hamming_distance([_|As], [_|Bs]) ->
+  1 + hamming_distance(As, Bs).
diff --git a/rna-transcription/dna_tests.erl b/rna-transcription/dna_tests.erl
new file mode 100644
index 00000000..18e2105e
--- /dev/null
+++ b/rna-transcription/dna_tests.erl
@@ -0,0 +1,20 @@
+-module( dna_tests ).
+-include_lib("eunit/include/eunit.hrl").
+
+transcribes_cytidine_unchanged_test() ->
+  ?assertEqual("C", dna:to_rna("C")).
+
+transcribes_guanosine_unchanged_test() ->
+  ?assertEqual("G", dna:to_rna("G")).
+
+transcribes_adenosine_unchanged_test() ->
+  ?assertEqual("A", dna:to_rna("A")).
+
+transcribes_thymidine_to_uracil_test() ->
+  ?assertEqual("U", dna:to_rna("T")).
+
+transcribes_all_occurences_test() ->
+  ?assertEqual(
+      "ACGUGGUCUUAA",
+      dna:to_rna("ACGTGGTCTTAA")
+  ).
diff --git a/trinary/example_tests.erl b/trinary/example_tests.erl
new file mode 100644
index 00000000..3337a398
--- /dev/null
+++ b/trinary/example_tests.erl
@@ -0,0 +1,34 @@
+-module( example_tests ).
+
+-include_lib("eunit/include/eunit.hrl").
+
+trinary_1_is_decimal_1_test() ->
+  ?assertEqual(1, example:to_decimal("1")).
+
+trinary_2_is_decimal_2_test() ->
+  ?assertEqual(2, example:to_decimal("2")).
+
+trinary_10_is_decimal_3_test() ->
+  ?assertEqual(3, example:to_decimal("10")).
+
+trinary_11_is_decimal_4_test() ->
+  ?assertEqual(4, example:to_decimal("11")).
+
+trinary_100_is_decimal_9_test() ->
+  ?assertEqual(9, example:to_decimal("100")).
+
+trinary_112_is_decimal_14_test() ->
+  ?assertEqual(14, example:to_decimal("112")).
+
+trinary_222_is_decimal_26_test() ->
+  ?assertEqual(26, example:to_decimal("222")).
+
+trinary_1120_is_decimal_42_test() ->
+  ?assertEqual(42, example:to_decimal("1120")).
+
+trinary_1122000120_is_decimal_32091_test() ->
+  ?assertEqual(32091, example:to_decimal("1122000120")).
+
+invalid_trinary_is_decimal_0_test() ->
+  ?assertEqual(0, example:to_decimal("carrot")).
+
diff --git a/trinary/trinary_test.erl b/trinary/trinary_test.erl
new file mode 100644
index 00000000..9a1c6c81
--- /dev/null
+++ b/trinary/trinary_test.erl
@@ -0,0 +1,34 @@
+-module(trinary_test).
+-import(example, [to_decimal/1]).
+-include_lib("eunit/include/eunit.hrl").
+
+trinary_1_is_decimal_1_test() ->
+  ?assertEqual(1, example:to_decimal("1")).
+
+trinary_2_is_decimal_2_test() ->
+  ?assertEqual(2, example:to_decimal("2")).
+
+trinary_10_is_decimal_3_test() ->
+  ?assertEqual(3, example:to_decimal("10")).
+
+trinary_11_is_decimal_4_test() ->
+  ?assertEqual(4, example:to_decimal("11")).
+
+trinary_100_is_decimal_9_test() ->
+  ?assertEqual(9, example:to_decimal("100")).
+
+trinary_112_is_decimal_14_test() ->
+  ?assertEqual(14, example:to_decimal("112")).
+
+trinary_222_is_decimal_26_test() ->
+  ?assertEqual(26, example:to_decimal("222")).
+
+trinary_1120_is_decimal_42_test() ->
+  ?assertEqual(42, example:to_decimal("1120")).
+
+trinary_1122000120_is_decimal_32091_test() ->
+  ?assertEqual(32091, example:to_decimal("1122000120")).
+
+invalid_trinary_is_decimal_0_test() ->
+  ?assertEqual(0, example:to_decimal("carrot")).
+
diff --git a/trinary/trinary_tests.erl b/trinary/trinary_tests.erl
deleted file mode 100644
index ba27ab42..00000000
--- a/trinary/trinary_tests.erl
+++ /dev/null
@@ -1,34 +0,0 @@
--module(trinary_tests).
--import(example, [to_decimal/1]).
--include_lib("eunit/include/eunit.hrl").
-
-trinary_1_is_decimal_1_test() ->
-  ?assertEqual(1, example:to_decimal("1")).
-
-%% trinary_2_is_decimal_2_test() ->
-%%   ?assertEqual(2, example:to_decimal("2")).
-
-%% trinary_10_is_decimal_3_test() ->
-%%   ?assertEqual(3, example:to_decimal("10")).
-
-%% trinary_11_is_decimal_4_test() ->
-%%   ?assertEqual(4, example:to_decimal("11")).
-
-%% trinary_100_is_decimal_9_test() ->
-%%   ?assertEqual(9, example:to_decimal("100")).
-
-%% trinary_112_is_decimal_14_test() ->
-%%   ?assertEqual(14, example:to_decimal("112")).
-
-%% trinary_222_is_decimal_26_test() ->
-%%   ?assertEqual(26, example:to_decimal("222")).
-
-%% trinary_1120_is_decimal_42_test() ->
-%%   ?assertEqual(42, example:to_decimal("1120")).
-
-%% trinary_1122000120_is_decimal_32091_test() ->
-%%   ?assertEqual(32091, example:to_decimal("1122000120")).
-
-%% invalid_trinary_is_decimal_0_test() ->
-%%   ?assertEqual(0, example:to_decimal("carrot")).
-
diff --git a/word-count/word_count_tests.erl b/word-count/word_count_tests.erl
new file mode 100644
index 00000000..73fd98c3
--- /dev/null
+++ b/word-count/word_count_tests.erl
@@ -0,0 +1,66 @@
+-module( word_count_tests ).
+-include_lib("eunit/include/eunit.hrl").
+
+%% dict should be used to implement wound_count:count/1.
+
+count_one_word_test() ->
+    assert_count(
+      "word",
+      [{"word", 1}]).
+
+count_one_of_each_test() ->
+    assert_count(
+      "one of each",
+      [{"one", 1},
+       {"of", 1},
+       {"each", 1}]).
+
+count_multiple_occurrences_test() ->
+    assert_count(
+      "one fish two fish red fish blue fish",
+      [{"one", 1},
+       {"two", 1},
+       {"fish", 4},
+       {"red", 1},
+       {"blue", 1}]).
+
+ignore_punctuation_test() ->
+    assert_count(
+      "car : carpet as java : javascript!!&@$%^&",
+      [{"car", 1},
+       {"carpet", 1},
+       {"as", 1},
+       {"java", 1},
+       {"javascript", 1}]).
+
+include_numbers_test() ->
+    assert_count(
+      "testing, 1, 2 testing",
+      [{"testing", 2},
+       {"1", 1},
+       {"2", 1}]).
+
+normalize_case_test() ->
+    assert_count(
+      "go Go GO",
+      [{"go", 3}]).
+
+prefix_punctuation_test() ->
+    assert_count(
+      "!%%#testing, 1, 2 testing",
+      [{"testing", 2},
+       {"1", 1},
+       {"2", 1}]).
+
+symbols_are_separators_test() ->
+    assert_count(
+      "hey,my_spacebar_is_broken.",
+      [{"hey", 1},
+       {"my", 1},
+       {"spacebar", 1},
+       {"is", 1},
+       {"broken", 1}]).
+
+assert_count(S, Expect) ->
+    ?assertEqual(orddict:from_list(dict:to_list(word_count:count(S))),
+                 orddict:from_list(Expect)).