The pipeline is divided in two main sections for ancient and modern samples. At the end, there are two additional steps to merge and filter all samples (both ancient and modern) together.
There are three main steps to go from FASTQ files to a filtered multi-sample vcf file:
- FASTQ -> BAM.
- BAM -> VCF.
- Python (v3).
- SAMtools (v1.9).
- BWA (v0.7.12).
- Cutadapt (v1.9.1).
- softclip.py (provided in scripts folder).
- Picard (v2.9.2).
- GenomeAnalysisToolkit (v3.7).
- A sample information file (csv format).
- A parameter and links file (csv format).
- The alignment script "make_aligment_script.py" which makes an executable bash script.
The sample information file should have four columns of information in csv format: sample id, input gzipped fastq file, library index and library ID.
Example sample information file
sample_id,fastq_file,barcode,library
KK1,KK1_1_1.fastq.gz,AGACTCC,KK1_AGACTCC_hiseq17
KK1,KK1_2_1.fastq.gz,GTTACCG,KK1_GTTACCG_hiseq17
NE5,NE5_1_1.fastq.gz,ACGGCAG,NE5_ACGGCAG_hiseq17
NE5,NE5_2_1.fastq.gz,GACCGAT,NE5_GACCGAT_hiseq17
ZVEJ31,ZVEJ31_1_1.fastq.gz,GGTAACT,ZVEJ31_GGTAACT_hiseq17
This file should contain links to program paths and the reference genome. It should also contain parameter information for Cutadapt, BWA and the mapping quality threshold for read filtering.
Example parameters and links file
paths:,
Reference:,/home/pm604/ref_genome/hg19_with_rCRS_ordered/hg19_with_rCRS_ordered.fa
Picard:,/home/pm604/tools/picard/picard.jar
GATK:,/home/pm604/tools/GenomeAnalysisTK-3.7-0/GenomeAnalysisTK.jar
softclip.py:,/home/pm604/scripts/softclip.py
,
parameters:,
Cutadapt:,-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -O 1 -m 34 -j 32
BWA aln:,-l 1000 -t 32 -n0.01 -o2
mapping quality threshold:,20
The options -t and -j for BWA and Cutadapt respectively are set to use 32 CPUs. They need to be adjusted depedning on the system.
This python script "make_aligment_script.py" creates an alignment script which should be run with bash. It works on gzipped fastq files which have already been split by library index. Adapters are trimmed from the end of reads with Cutadapt using the parameters set in the parameter file. The reads are aligned using BWA (parameters set in parameter file) and the files are sorted and indexed using SAMtools. All steps apart from the BWA aln step are run in parallel so you will need as many cores as input files. If this is an issue you should split your sample information file into smaller files and run commands in series. Only run one alignment bash script per folder (or else output statistics files will be overwritten). The number of threads to use for the BWA aln step should be set in the parameter file.
Reads from the same sample are merged using Picard. Reads are filtering by a mapping quality threshold set in the parameter file. Duplicate reads are removed using SAMtools. Indels are realigned using The Genome Analysis Toolkit and 2bp are softclip from the start and ends of reads.
Basic alignment statistics are provided in "alignment_stats" output files.
The robusticity of this pipeline has not been tested extensively. It is recommended to use the template input files provided and to check the alignment bash script before running it.
Running the python and bash scripts
python make_aligment_script.py <sample_information_file.csv> <parameters_and_links_file.csv> <output_file.sh>
bash output_file.sh
Convert from BAM files to filtered VCF files.
- Python (v3)
- SAMtools (v1.9).
- GenomeAnalysisToolkit (v3.7).
- VCFtools (v0.1.5).
- filter_GC.py (provided in scripts folder).
- filter_vcf_minDepth_maxDepth.py (provided in scripts folder).
- A parameter and links file (csv format).
- The filter_ancient_bams.sh script.
The parameter and links file should contain links to the reference genome and a link to lists of positions you want to call in your sample(s). This list should be split by chromosome. I am using Gronau regions (see README ). It should also contain links to GATK, VCFtools and python scripts (provided in scripts).
The parameter and links file should specify the minimum and maximum genotype depth for filtering. The depth can be written in absolute terms or an X can be used to specify the coverage relative to the average genotype coverage within the Gronau windows e.g. max_depth: 2X is 2 times the average coverage.
The clean_up option specifies whether you want intermediate files to be deleted (Y/N), and merge specifies whether you want a single vcf file at the end (Y) or one vcf per chromosome (N).
Example parameters and links file
data,
snp_list:,/home/pm604/Gronau_filters/Gronau_regions_to_keep_per_chromosome/chr_in_chr_name
reference_genome:,/home/pm604/ref_genome/hg19_with_rCRS_ordered/hg19_with_rCRS_ordered.fa
,
links,
GATK:,/home/pm604/tools/GenomeAnalysisTK-3.7-0/GenomeAnalysisTK.jar
filter_GC.py:,/home/pm604/scripts/filter_GC.py
filter_vcf_minDepth_maxDepth.py:,/home/pm604/scripts/filter_vcf_minDepth_maxDepth.py
vcf-concat:,vcf-concat
,
options,
min_depth:,8
max_depth:,2X
clean_up:,Y
merge:,N
You will need a machine which has at least 23 cores. BAM files are split by chromosome (autosomes only) and genotypes called using Genome Analysis Toolkit Unified Genotyper. The input priors are set to equal for homozygous reference and homozygous alternate genotypes (as done for the Simons Genome Diversity panel). Positions of interest are specified in the parameters and links file. Positions where there is a G with a C called immediately up or downstream are removed as are positions with a C called and a G immediately up or downstream of it. C and G sites with a missing genotype immediately preceding or proceeding it are also removed. Genotypes are filtered by a minimum and maximum depth threshold as specified in the parameters and links file. The depth can be written in absolute terms or an X can be used to specify the coverage relative to the average genotype coverage within the Gronau windows e.g. max_depth: 2X is 2 times the average coverage.
Running the script
bash filter_ancient_bams.sh <parameters_and_links.csv>Mondern samples were processed from bam files. All modern samples were downloaded from the Cancer Genomics Cloud except for JHM06 which is described in McColl H et al., 2018.
- BAM -> VCF.
Convert BAM files to filtered VCF files.
- Python (v3)
- SAMtools (v1.9).
- GenomeAnalysisToolkit (v3.7).
- VCFtools (v0.1.5).
- filter_GC.py (provided in scripts folder).
- filter_vcf_minDepth_maxDepth.py (provided in scripts folder).
- The filter_modern_bams.sh script.
You will need a machine which has at least 23 cores. BAM files are split by chromosome (autosomes only) and genotypes called using Genome Analysis Toolkit Unified Genotyper. Only sites within the Gronau regions will be called (see README ). The input priors are set to equal for homozygous reference and homozygous alternate genotypes (as done for the Simons Genome Diversity panel). Positions where there is a G with a C called immediately up or downstream are removed as are positions with a C called and a G immediately up or downstream of it. C and G sites with a missing genotype immediately preceding or proceeding it are also removed. Genotypes are filtered by a minimum coverage of 20x and maximum depth defined as twice the average genotype coverage within the Gronau regions. Paths to specific tools/scripts, bed files containing the intervals of the Gronau regions and reference genome have to be manually changed within the filter_modern_bams.sh script
Running the script
The script should be submitted within the folder containing the BAM file.
bash filter_modern_bams.shAfter VCF files have been generated for both modern and ancient samples, they can be merged into a final dataset
- Merging VCF files.
- Filtering final dataset.
VCF files are merged semi-manually. It is more efficient to merge per chromosome across samples (can be run in parallel) and then concatenate the chromosomes together (i.e. merge sample1_chr1 sample2_chr1 sample3_chr1 > all_samples_chr1. Then merge all_samples_chr1 all_samples_chr2 etc) than to merge across all chromosomes within a sample and then merge across samples. An example script "merge_vcf_example.sh" which merges files using VCFtools can be found in the scripts folder. If you already have vcf files per sample and you want to merge them across samples, you can use bcftools merge -O z --threads 32 sample1.vcf.gz sample2.vcf.gz sample3.vcf.gz > final_dataset.vcf.gz.
After merging, the dataset is filtered to remove all missing data and triallelic sites.
All sites showing even just one missing genotype across the dataset are discarded using vcftools:
vcftools --gzvcf final_dataset.vcf.gz" --max-missing 1 --recode-INFO-all --recode --stdout | bgzip -c -@ 32 > final_dataset_noMissing.vcf.gz
Triallelic site are removed with bcftools:
bcftools view final_dataset_noMissing.vcf.gz -O z -m1 -M2 --threads 32 -o final_dataset_noMissing_noTriallelic.vcf.gz
The number of transitions and transversions is calculate using bcftools:
bcftools stats -s - final_dataset_noMissing_noTriallelic.vcf.gz > final_dataset_noMissing_noTriallelic_bcftools_stats