Skip to content

oicr-gsi/xenoclassify-workflow

Repository files navigation

xenoClassify

Xenoclassify workflow classifies short-read sequencing data generated from xenograft samples. It requires alignment to the reference genomes of the graft and host species using bwamem2 or STAR. Once aligned, reads (or read pairs) are assessed to identify the likely source of the cells from which the DNA/RNA was extracted. The output is a bam file with reads tagged to indicate the source species. Also, the workflow creates a report in JSON format. The workflow uses XenoClassify.

Xenoclassify, how it works

Overview

This workflow aligns reads to Host and Graft reference genomes, classifies and filters data. There is a built-in support for single- and multi-lane alignment for RNA-seq

Dependencies

Usage

Cromwell

java -jar cromwell.jar run xenoclassify.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter Value Description
inputs Array[InputGroup] Array of fastq files for read 1 and 2 along with rG string
reference String The reference of Graft to align the data with by either STAR or BWA
libraryDesign String Supported library design acronym. We support WG, EX, TS, WT and MR. Default is WG

Optional workflow parameters:

Parameter Value Default Description
hostReference String "mm10" The reference for host, most of the time it is mouse mm10
outputFileNamePrefix String "" Output file name prefix
filterSupAlignments Boolean true Remove supplemental alignments from WT data (default true)

Optional task parameters:

Parameter Value Default Description
generateHostBamWG.adapterTrimmingLog_timeout Int 48 Hours before task timeout
generateHostBamWG.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
generateHostBamWG.indexBam_timeout Int 48 Hours before task timeout
generateHostBamWG.indexBam_modules String "samtools/1.9" Modules for running indexing job
generateHostBamWG.indexBam_jobMemory Int 12 Memory allocated indexing job
generateHostBamWG.bamMerge_timeout Int 72 Hours before task timeout
generateHostBamWG.bamMerge_modules String "samtools/1.9" Required environment modules
generateHostBamWG.bamMerge_jobMemory Int 32 Memory allocated indexing job
generateHostBamWG.runBwamem2_timeout Int 96 Hours before task timeout
generateHostBamWG.runBwamem2_jobMemory Int 32 Memory allocated for this job
generateHostBamWG.runBwamem2_threads Int 8 Requested CPU threads
generateHostBamWG.runBwamem2_addParam String? None Additional BWA parameters
generateHostBamWG.adapterTrimming_timeout Int 48 Hours before task timeout
generateHostBamWG.adapterTrimming_jobMemory Int 16 Memory allocated for this job
generateHostBamWG.adapterTrimming_addParam String? None Additional cutadapt parameters
generateHostBamWG.adapterTrimming_adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" Adapter sequence to trim from read 2
generateHostBamWG.adapterTrimming_adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" Adapter sequence to trim from read 1
generateHostBamWG.adapterTrimming_trimMinQuality Int 0 Minimum quality of read ends to keep
generateHostBamWG.adapterTrimming_trimMinLength Int 1 Minimum length of reads to keep
generateHostBamWG.adapterTrimming_umiLength Int 5 The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
generateHostBamWG.adapterTrimming_doUMItrim Boolean false If true, do umi trimming
generateHostBamWG.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
generateHostBamWG.extractUMIs_timeout Int 12 Time in hours before task timeout
generateHostBamWG.extractUMIs_jobMemory Int 24 Memory allocated for this job
generateHostBamWG.extractUMIs_modules String "barcodex-rs/0.1.2 rust/1.45.1" Required environment modules
generateHostBamWG.extractUMIs_pattern2 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateHostBamWG.extractUMIs_pattern1 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateHostBamWG.extractUMIs_outputPrefix String "extractUMIs_output" Specifies the start of the output files
generateHostBamWG.extractUMIs_umiList String "umiList" Reference file with valid UMIs
generateHostBamWG.slicerR2_timeout Int 48 Hours before task timeout
generateHostBamWG.slicerR2_jobMemory Int 16 Memory allocated for this job
generateHostBamWG.slicerR2_modules String "slicer/0.3.0" Required environment modules
generateHostBamWG.slicerR1_timeout Int 48 Hours before task timeout
generateHostBamWG.slicerR1_jobMemory Int 16 Memory allocated for this job
generateHostBamWG.slicerR1_modules String "slicer/0.3.0" Required environment modules
generateHostBamWG.countChunkSize_timeout Int 48 Hours before task timeout
generateHostBamWG.countChunkSize_jobMemory Int 16 Memory allocated for this job
generateHostBamWG.countChunkSize_modules String "python/3.7" Required environment modules
generateHostBamWG.numChunk Int 1 Number of chunks to split fastq file [1, no splitting]
generateHostBamWG.doUMIextract Boolean false If true, UMI will be extracted before alignment [false]
generateHostBamWG.doTrim Boolean false If true, adapters will be trimmed before alignment [false]
generateHostBamWG.numReads Int? None Number of reads
generateGraftBamWG.adapterTrimmingLog_timeout Int 48 Hours before task timeout
generateGraftBamWG.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
generateGraftBamWG.indexBam_timeout Int 48 Hours before task timeout
generateGraftBamWG.indexBam_modules String "samtools/1.9" Modules for running indexing job
generateGraftBamWG.indexBam_jobMemory Int 12 Memory allocated indexing job
generateGraftBamWG.bamMerge_timeout Int 72 Hours before task timeout
generateGraftBamWG.bamMerge_modules String "samtools/1.9" Required environment modules
generateGraftBamWG.bamMerge_jobMemory Int 32 Memory allocated indexing job
generateGraftBamWG.runBwamem2_timeout Int 96 Hours before task timeout
generateGraftBamWG.runBwamem2_jobMemory Int 32 Memory allocated for this job
generateGraftBamWG.runBwamem2_threads Int 8 Requested CPU threads
generateGraftBamWG.runBwamem2_addParam String? None Additional BWA parameters
generateGraftBamWG.adapterTrimming_timeout Int 48 Hours before task timeout
generateGraftBamWG.adapterTrimming_jobMemory Int 16 Memory allocated for this job
generateGraftBamWG.adapterTrimming_addParam String? None Additional cutadapt parameters
generateGraftBamWG.adapterTrimming_adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" Adapter sequence to trim from read 2
generateGraftBamWG.adapterTrimming_adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" Adapter sequence to trim from read 1
generateGraftBamWG.adapterTrimming_trimMinQuality Int 0 Minimum quality of read ends to keep
generateGraftBamWG.adapterTrimming_trimMinLength Int 1 Minimum length of reads to keep
generateGraftBamWG.adapterTrimming_umiLength Int 5 The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
generateGraftBamWG.adapterTrimming_doUMItrim Boolean false If true, do umi trimming
generateGraftBamWG.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
generateGraftBamWG.extractUMIs_timeout Int 12 Time in hours before task timeout
generateGraftBamWG.extractUMIs_jobMemory Int 24 Memory allocated for this job
generateGraftBamWG.extractUMIs_modules String "barcodex-rs/0.1.2 rust/1.45.1" Required environment modules
generateGraftBamWG.extractUMIs_pattern2 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateGraftBamWG.extractUMIs_pattern1 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
generateGraftBamWG.extractUMIs_outputPrefix String "extractUMIs_output" Specifies the start of the output files
generateGraftBamWG.extractUMIs_umiList String "umiList" Reference file with valid UMIs
generateGraftBamWG.slicerR2_timeout Int 48 Hours before task timeout
generateGraftBamWG.slicerR2_jobMemory Int 16 Memory allocated for this job
generateGraftBamWG.slicerR2_modules String "slicer/0.3.0" Required environment modules
generateGraftBamWG.slicerR1_timeout Int 48 Hours before task timeout
generateGraftBamWG.slicerR1_jobMemory Int 16 Memory allocated for this job
generateGraftBamWG.slicerR1_modules String "slicer/0.3.0" Required environment modules
generateGraftBamWG.countChunkSize_timeout Int 48 Hours before task timeout
generateGraftBamWG.countChunkSize_jobMemory Int 16 Memory allocated for this job
generateGraftBamWG.countChunkSize_modules String "python/3.7" Required environment modules
generateGraftBamWG.numChunk Int 1 Number of chunks to split fastq file [1, no splitting]
generateGraftBamWG.doUMIextract Boolean false If true, UMI will be extracted before alignment [false]
generateGraftBamWG.doTrim Boolean false If true, adapters will be trimmed before alignment [false]
generateGraftBamWG.numReads Int? None Number of reads
sortHostBamWG.jobMemory Int 10 Memory allocated to sort task
sortHostBamWG.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
sortHostBamWG.modules String "samtools/1.14" Names and versions of modules needed for sorting
sortHostBamWG.filterSupAlignments Boolean true Optional flag for removing supplemental (chimeric) alignments to prevent failures with WT data
sortHostBamWG.timeout Int 72 Timeout for this task in hours
sortGraftBamWG.jobMemory Int 10 Memory allocated to sort task
sortGraftBamWG.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
sortGraftBamWG.modules String "samtools/1.14" Names and versions of modules needed for sorting
sortGraftBamWG.filterSupAlignments Boolean true Optional flag for removing supplemental (chimeric) alignments to prevent failures with WT data
sortGraftBamWG.timeout Int 72 Timeout for this task in hours
classifyWG.modules String "samtools/1.14 xenoclassify/1.0" Names and versions of modules needed for classification
classifyWG.jobMemory Int 10 Memory allocated to classify task
classifyWG.neitherThreshold Int 20 Threshold for score below which the reads are classified as 'neither'
classifyWG.tolerance Int 5 Tolerance around the mean of alignment scores for a set of reads classified as 'both'
classifyWG.difference Int 5 Difference between the sum of host and graft alignment scores for a set of reads classified as 'both'
classifyWG.timeout Int 72 Timeout for this task in hours
filterHostWG.modules String "samtools/1.14" Names and versions of modules needed for filtering
filterHostWG.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
filterHostWG.filterTags Array[String] ["host"] Filter reads with these tags
filterHostWG.jobMemory Int 5 Memory allocated to filtering task
filterHostWG.timeout Int 72 Timeout for this task in hours
mergeBams.modules String "samtools/1.14" Environment modules for the task
mergeBams.jobMemory Int 8 Memory for the task, in gigabytes
mergeBams.timeout Int 8 Timeout for the task, in hours
mergeReportsWG.modules String "" Environment modules for the task
mergeReportsWG.jobMemory Int 4 Memory for the task, in gigabytes
mergeReportsWG.timeout Int 4 Timeout for the task, in hours
generateHostBamWT.indexBam_timeout Int 48 hours before task timeout
generateHostBamWT.indexBam_modules String "picard/2.19.2" modules for running indexing job
generateHostBamWT.indexBam_jobMemory Int 12 Memory allocated indexing job
generateHostBamWT.runStar_timeout Int 72 hours before task timeout
generateHostBamWT.runStar_jobMemory Int 64 Memory allocated for this job
generateHostBamWT.runStar_threads Int 6 Requested CPU threads
generateHostBamWT.runStar_peOvMMp Float 0.1 maximum proportion of mismatched bases in the overlap area
generateHostBamWT.runStar_chimSegmentReadGapMax Int 3 maximum gap in the read sequence between chimeric segments
generateHostBamWT.runStar_peOvNbasesMin Int 10 minimum number of overlap bases to trigger mates merging and realignment
generateHostBamWT.runStar_chimNonchimScoDMin Int 10 to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateHostBamWT.runStar_chimMulmapNmax Int 50 maximum number of chimeric multi-alignments
generateHostBamWT.runStar_chimScoreSeparation Int 1 minimum difference (separation) between the best chimeric score and the next one
generateHostBamWT.runStar_chimScoJunNonGTAG Int -1 penalty for a non-GTAG chimeric junction
generateHostBamWT.runStar_chimMulmapScoRan Int 3 the score range for multi-mapping chimeras below the best chimeric score
generateHostBamWT.runStar_alignIntMax Int 100000 maximum intron size
generateHostBamWT.runStar_alignMatGapMax Int 100000 maximum gap between two mates
generateHostBamWT.runStar_alignSJDBOvMin Int 10 minimum overhang for annotated spliced alignments
generateHostBamWT.runStar_chimJunOvMin Int 10 minimum overhang for a chimeric junction
generateHostBamWT.runStar_chimSegmin Int 10 minimum length of chimeric segment length
generateHostBamWT.runStar_multiMax Int -1 multiMax parameter for STAR
generateHostBamWT.runStar_saSparsed Int 2 saSparsed parameter for STAR
generateHostBamWT.runStar_uniqMAPQ Int 255 Score for unique mappers
generateHostBamWT.runStar_chimScoreDropMax Int 30 max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateHostBamWT.runStar_outFilterMultimapNmax Int 50 max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateHostBamWT.runStar_chimOutType String "WithinBAM SoftClip Junctions" Indicate where chimeric reads are to be written
generateHostBamWT.runStar_addParam String? None Additional STAR parameters
generateHostBamWT.runStar_genereadSuffix String "ReadsPerGene.out" ReadsPerGene file suffix
generateHostBamWT.runStar_chimericjunctionSuffix String "Chimeric.out" Suffix for chimeric junction file
generateHostBamWT.runStar_transcriptomeSuffix String "Aligned.toTranscriptome.out" Suffix for transcriptome-aligned file
generateHostBamWT.runStar_starSuffix String "Aligned.sortedByCoord.out" Suffix for sorted file
sortHostBamWT.jobMemory Int 10 Memory allocated to sort task
sortHostBamWT.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
sortHostBamWT.modules String "samtools/1.14" Names and versions of modules needed for sorting
sortHostBamWT.timeout Int 72 Timeout for this task in hours
generateGraftBamWT.indexBam_timeout Int 48 hours before task timeout
generateGraftBamWT.indexBam_modules String "picard/2.19.2" modules for running indexing job
generateGraftBamWT.indexBam_jobMemory Int 12 Memory allocated indexing job
generateGraftBamWT.runStar_timeout Int 72 hours before task timeout
generateGraftBamWT.runStar_jobMemory Int 64 Memory allocated for this job
generateGraftBamWT.runStar_threads Int 6 Requested CPU threads
generateGraftBamWT.runStar_peOvMMp Float 0.1 maximum proportion of mismatched bases in the overlap area
generateGraftBamWT.runStar_chimSegmentReadGapMax Int 3 maximum gap in the read sequence between chimeric segments
generateGraftBamWT.runStar_peOvNbasesMin Int 10 minimum number of overlap bases to trigger mates merging and realignment
generateGraftBamWT.runStar_chimNonchimScoDMin Int 10 to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateGraftBamWT.runStar_chimMulmapNmax Int 50 maximum number of chimeric multi-alignments
generateGraftBamWT.runStar_chimScoreSeparation Int 1 minimum difference (separation) between the best chimeric score and the next one
generateGraftBamWT.runStar_chimScoJunNonGTAG Int -1 penalty for a non-GTAG chimeric junction
generateGraftBamWT.runStar_chimMulmapScoRan Int 3 the score range for multi-mapping chimeras below the best chimeric score
generateGraftBamWT.runStar_alignIntMax Int 100000 maximum intron size
generateGraftBamWT.runStar_alignMatGapMax Int 100000 maximum gap between two mates
generateGraftBamWT.runStar_alignSJDBOvMin Int 10 minimum overhang for annotated spliced alignments
generateGraftBamWT.runStar_chimJunOvMin Int 10 minimum overhang for a chimeric junction
generateGraftBamWT.runStar_chimSegmin Int 10 minimum length of chimeric segment length
generateGraftBamWT.runStar_multiMax Int -1 multiMax parameter for STAR
generateGraftBamWT.runStar_saSparsed Int 2 saSparsed parameter for STAR
generateGraftBamWT.runStar_uniqMAPQ Int 255 Score for unique mappers
generateGraftBamWT.runStar_chimScoreDropMax Int 30 max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateGraftBamWT.runStar_outFilterMultimapNmax Int 50 max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateGraftBamWT.runStar_chimOutType String "WithinBAM SoftClip Junctions" Indicate where chimeric reads are to be written
generateGraftBamWT.runStar_addParam String? None Additional STAR parameters
generateGraftBamWT.runStar_genereadSuffix String "ReadsPerGene.out" ReadsPerGene file suffix
generateGraftBamWT.runStar_chimericjunctionSuffix String "Chimeric.out" Suffix for chimeric junction file
generateGraftBamWT.runStar_transcriptomeSuffix String "Aligned.toTranscriptome.out" Suffix for transcriptome-aligned file
generateGraftBamWT.runStar_starSuffix String "Aligned.sortedByCoord.out" Suffix for sorted file
sortGraftBamWT.jobMemory Int 10 Memory allocated to sort task
sortGraftBamWT.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
sortGraftBamWT.modules String "samtools/1.14" Names and versions of modules needed for sorting
sortGraftBamWT.timeout Int 72 Timeout for this task in hours
classifyWT.modules String "samtools/1.14 xenoclassify/1.0" Names and versions of modules needed for classification
classifyWT.jobMemory Int 10 Memory allocated to classify task
classifyWT.neitherThreshold Int 20 Threshold for score below which the reads are classified as 'neither'
classifyWT.tolerance Int 5 Tolerance around the mean of alignment scores for a set of reads classified as 'both'
classifyWT.difference Int 5 Difference between the sum of host and graft alignment scores for a set of reads classified as 'both'
classifyWT.timeout Int 72 Timeout for this task in hours
filterHostWT.modules String "samtools/1.14" Names and versions of modules needed for filtering
filterHostWT.tmpDir String? None Optionally supply tmpDir for writing chunk bam files for sorting
filterHostWT.filterTags Array[String] ["host"] Filter reads with these tags
filterHostWT.jobMemory Int 5 Memory allocated to filtering task
filterHostWT.timeout Int 72 Timeout for this task in hours
makeFastq.jobMemory Int 24 Memory allocated to the task.
makeFastq.overhead Int 6 Ovrerhead for calculating heap memory, difference between total and Java-allocated memory
makeFastq.timeout Int 20 Timeout in hours, needed to override imposed limits.
makeFastq.picardParams String "VALIDATION_STRINGENCY=LENIENT" Additional parameters for picard SamToFastq, Default is VALIDATION_STRINGENCY=LENIENT
makeFastq.modules String "samtools/1.14 picard/2.21.2" Names and versions of required modules.
generateFinalBamWT.indexBam_timeout Int 48 hours before task timeout
generateFinalBamWT.indexBam_modules String "picard/2.19.2" modules for running indexing job
generateFinalBamWT.indexBam_jobMemory Int 12 Memory allocated indexing job
generateFinalBamWT.runStar_timeout Int 72 hours before task timeout
generateFinalBamWT.runStar_jobMemory Int 64 Memory allocated for this job
generateFinalBamWT.runStar_threads Int 6 Requested CPU threads
generateFinalBamWT.runStar_peOvMMp Float 0.1 maximum proportion of mismatched bases in the overlap area
generateFinalBamWT.runStar_chimSegmentReadGapMax Int 3 maximum gap in the read sequence between chimeric segments
generateFinalBamWT.runStar_peOvNbasesMin Int 10 minimum number of overlap bases to trigger mates merging and realignment
generateFinalBamWT.runStar_chimNonchimScoDMin Int 10 to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
generateFinalBamWT.runStar_chimMulmapNmax Int 50 maximum number of chimeric multi-alignments
generateFinalBamWT.runStar_chimScoreSeparation Int 1 minimum difference (separation) between the best chimeric score and the next one
generateFinalBamWT.runStar_chimScoJunNonGTAG Int -1 penalty for a non-GTAG chimeric junction
generateFinalBamWT.runStar_chimMulmapScoRan Int 3 the score range for multi-mapping chimeras below the best chimeric score
generateFinalBamWT.runStar_alignIntMax Int 100000 maximum intron size
generateFinalBamWT.runStar_alignMatGapMax Int 100000 maximum gap between two mates
generateFinalBamWT.runStar_alignSJDBOvMin Int 10 minimum overhang for annotated spliced alignments
generateFinalBamWT.runStar_chimJunOvMin Int 10 minimum overhang for a chimeric junction
generateFinalBamWT.runStar_chimSegmin Int 10 minimum length of chimeric segment length
generateFinalBamWT.runStar_multiMax Int -1 multiMax parameter for STAR
generateFinalBamWT.runStar_saSparsed Int 2 saSparsed parameter for STAR
generateFinalBamWT.runStar_uniqMAPQ Int 255 Score for unique mappers
generateFinalBamWT.runStar_chimScoreDropMax Int 30 max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
generateFinalBamWT.runStar_outFilterMultimapNmax Int 50 max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
generateFinalBamWT.runStar_chimOutType String "WithinBAM SoftClip Junctions" Indicate where chimeric reads are to be written
generateFinalBamWT.runStar_addParam String? None Additional STAR parameters
generateFinalBamWT.runStar_genereadSuffix String "ReadsPerGene.out" ReadsPerGene file suffix
generateFinalBamWT.runStar_chimericjunctionSuffix String "Chimeric.out" Suffix for chimeric junction file
generateFinalBamWT.runStar_transcriptomeSuffix String "Aligned.toTranscriptome.out" Suffix for transcriptome-aligned file
generateFinalBamWT.runStar_starSuffix String "Aligned.sortedByCoord.out" Suffix for sorted file
mergeReportsWT.modules String "" Environment modules for the task
mergeReportsWT.jobMemory Int 4 Memory for the task, in gigabytes
mergeReportsWT.timeout Int 4 Timeout for the task, in hours

Outputs

Output Type Description Labels
filteredResults File bam file without host (most commonly mouse) reads vidarr_label: filteredResults
filteredResultsIndex File index file for file without host reads vidarr_label: filteredResultsIndex
starChimeric File? Chimeric Graft junctions, provisioned for WT data only vidarr_label: starChimeric
transcriptomeBam File? transcriptomeBam is a file produced for Graft WT data only vidarr_label: transcriptomeBam
geneReadFile File? .tab file with Graft gene read outs, only for WT data vidarr_label: geneReadFile
jsonReport File a simple stats file with counts for differently tagged reads vidarr_label: jsonReport

Commands

This section lists command(s) run by Xenoclassify workflow

  • Running Xenoclassify workflow

Xenoclassify aligns data to host and graft genomes using imported bwaMem (or star) workflow and then classify reads depending on their alignment scores. In the case of STAR we support multi-lane data. WG/EX/TS data are going to be aligned as single-lane data only.

Sort bam files by read name, optionally remove supplemental (chimeric) alignments

    if [[ "~{filterSupAlignments}" == "true" ]]; then
        samtools sort -n ~{inBam} ~{'-T ' + tmpDir} | samtools view -F 2048 - -bh > ~{basename(inBam, '.bam')}_sorted.bam
    else
        samtools sort -n ~{inBam} ~{'-T ' + tmpDir} -o ~{basename(inBam, '.bam')}_sorted.bam
    fi

Classify reads with xenoclassify.py script:

 
 xenoclassify.py is run on name-sorted bams from host and graft

 python3 $XENOCLASSIFY_ROOT/bin/xenoclassify/xenoclassify.py -H HOST_BAM -G GRAFT_BAM -O . -b -p PREFIX
                                                             -n NEITHER_THRESHOLD -t TOLERANCE -d DIFFERENCE
 ...

 samtools view PREFIX_output.bam | awk \'{print \$NF}\' | sort | uniq -c"
 counts = os.popen(command).read().splitlines() 

 Following Python code looks for host/graft (+ neither, both) classification and writes a summary into .json file

 for line in counts:
   if line.find('CL:Z:') == 0:
         continue
   line = line.rstrip()
   line = re.sub('CL:Z:', '', line)
   tmp = line.split()
   jsonDict[tmp[1]] = tmp[0]

 with open(json_name, 'w') as json_file:
   json.dump(jsonDict, json_file)
 

Filter reads matching the supplied classification(s) and provision filtered .bam along with its index

 
  The following python code splits the supplied tags and then 
  removes all matching reads from the bam file  
  
  ...

  inputTags =  "~{sep=' ' filterTags}"
  tags = inputTags.split()
  
  command = "samtools view -h XENOCLASSIFY_BAM"
  for t in tags:
    command = command + " | grep -v \'CL:Z:" + t + "\'"
  
  command = command + " | samtools sort -O bam -T  TMP_DIR -o OUTPUT_PREFIX_filtered.bam -"
  os.system(command)
  
  samtools index OUTPUT_PREFIX_filtered.bam OUTPUT_PREFIX_filtered.bai

Extract reads from filtered file into fastq format with picard:

 set -euo pipefail
 unset _JAVA_OPTIONS
 java -Xmx32G -jar picard.jar SamToFastq I=FILTERED_BAM F=FILTERED_1.fastq F2=FILTERED_2.fastq ADDITIONAL_PARAMETERS
 gzip -c FILTERED_1.fastq > OUTPUT_PREFIX_part_1.fastq.gz
 gzip -c FILTERED_2.fastq > OUTPUT_PREFIX_part_2.fastq.gz

In addition, we run second pass STAR alignments with reads from the filtered bam extracted into fastq

Merging reports - this is needed only for multi-lane transcriptome data processing For multi-lane data we also add lane identificators

   import json
   import re

   r = "~{sep=' ' inputReports}"
   inputJsons = r.split()
   inputRgs = "~{sep=' ' inputRgs}"

   data = {}

   def jsonRead(fileName):
       with open(fileName, "r") as f:
           jsonText = f.readlines()
           jsonText = "".join(jsonText)
           jsonText = jsonText.strip()
       return json.loads(jsonText)

   matches = re.findall('(?<=[ID]:)([\S]*)', inputRgs)

   if len(inputJsons) > 1:
       for j in range(len(inputJsons)):
           if matches[j]:
               data[matches[j]] = jsonRead(inputJsons[j])
   else:
       data = jsonRead(inputJsons[0])

   metrics_file = "~{outputPrefix}_tagReport.json"
   with open(metrics_file, "w") as m:
       m.write(json.dumps(data, indent=2))

Merging and indexing bam files

  set -euo pipefail
  samtools merge -o ~{outputPrefix}_filtered.bam ~{sep=" " inputBams}
  samtools index ~{outputPrefix}_filtered.bam ~{outputPrefix}_filtered.bai

Examples of json report for single-lane and multi-lane data:

single-lane:

{ "both": "286794", "host": "348954", "neither": "1140", "graft": "5607744" }

multi-lane:

{ "210601_A00469_0179_BHCKFVDRXY_1_CTGTTGAC-ACCTCAGT": { "both": "13188", "host": "5184", "graft": "233018" }, "210430_A00469_0173_AH7NV2DRXY_2_CTGTTGAC-ACCTCAGT": { "both": "11904", "host": "5076", "graft": "217000" } }

Support

For support, please file an issue on the Github project or send an email to [email protected] .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

About

workflow to classify short-read sequencing data generated from xenograft samples

Topics

Resources

Stars

Watchers

Forks

Packages

No packages published

Contributors 5