-
Notifications
You must be signed in to change notification settings - Fork 10
Deletions
Deletion - a deletion of some bases present in the reference sequence from a query sequence.
Figure 1: Deletion example
If a deletion difference has caused alignment fragmentation, it is output in the query_struct.gff and ref_struct.gff files, otherwise it is output in the query_snps.gff and ref_snps.gff files.
An example with the deletion entries in query_snps.gff :
##gff-version 3
##sequence-region query_1 1 13000
query_1 NucDiff_v2.0 SO:0000159 500 500 . . . ID=SNP_1;Name=deletion;del_len=5;query_dir=1;ref_sequence=ref_1;ref_coord=501-505;query_bases=-;ref_bases=tctcg;color=#0000EE
query_1 NucDiff_v2.0 SO:0000159 1499 1499 . . . ID=SNP_2;Name=deletion;del_len=20;query_dir=1;ref_sequence=ref_1;ref_coord=1505-1524;query_bases=-;ref_bases=tcttgattaactgttagata;color=#0000EE
query_1 NucDiff_v2.0 SO:0000159 2500 2500 . . . ID=SNP_3;Name=deletion;del_len=50;query_dir=1;ref_sequence=ref_1;ref_coord=2526-2575;query_bases=-;ref_bases=agatcagacctacgggaccaactattggatcagccgcgagaattagttag;color=#0000EE
query_1 NucDiff_v2.0 SO:0000159 3500 3500 . . . ID=SNP_4;Name=deletion;del_len=65;query_dir=1;ref_sequence=ref_1;ref_coord=3576-3640;query_bases=-;ref_bases=cgactgtgttgaatagtgtagttgtagataactgagcacaatgtatggtctaatttttacgtgaa;color=#0000EE
The query_snps.gff file contains the following information (see Figure 1 for notations):
| GFF3 fields | Content | Notes |
|---|---|---|
| col 1 | Query_seq | |
| col 2 | NucDiff_v2.0 | name and current version of the tool |
| col 3 | SO:0000159 | Sequence Ontology accession number corresponding to the "deletion" SO term |
| col 4 | Q_pos | |
| col 5 | Q_pos | |
| col 6/col 7/col8 | . | score/strand/phase fields are not used |
| col 9, ID | "SNP_1" | ID in query_snps.gff is equal to ID in ref_snps.gff |
| col 9, Name | "deletion" | |
| col 9, del_len | Length(Deletion) | |
| col 9, query_dir | "1" or "-1" | -1 if the deleted fragment should be reverse complemented before its insertion to a Query_seq |
| col 9, ref_sequence | Ref_seq | |
| col 9, ref_coord | Del_st - Del_end | |
| col 9, query_bases | "-" | |
| col 9, ref_bases | ATGC's | the subsequence is reverse complemented if the query_dir value is equal to -1 |
An example with the deletion entries in ref_snps.gff :
##gff-version 3
##sequence-region ref_1 1 15063
ref_1 NucDiff_v2.0 SO:0000159 501 505 . . . ID=SNP_1;Name=deletion;del_len=5;query_dir=1;query_sequence=query_1;query_coord=500;query_bases=-;ref_bases=tctcg;color=#0000EE
ref_1 NucDiff_v2.0 SO:0000159 1505 1524 . . . ID=SNP_2;Name=deletion;del_len=20;query_dir=1;query_sequence=query_1;query_coord=1499;query_bases=-;ref_bases=tcttgattaactgttagata;color=#0000EE
ref_1 NucDiff_v2.0 SO:0000159 2526 2575 . . . ID=SNP_3;Name=deletion;del_len=50;query_dir=1;query_sequence=query_1;query_coord=2500;query_bases=-;ref_bases=agatcagacctacgggaccaactattggatcagccgcgagaattagttag;color=#0000EE
ref_1 NucDiff_v2.0 SO:0000159 3576 3640 . . . ID=SNP_4;Name=deletion;del_len=65;query_dir=1;query_sequence=query_1;query_coord=3500;query_bases=-;ref_bases=cgactgtgttgaatagtgtagttgtagataactgagcacaatgtatggtctaatttttacgtgaa;color=#0000EE
The ref_snps.gff file contains the following information (see Figure 1 for notations):
| GFF3 fields | Content | Notes |
|---|---|---|
| col 1 | Ref_seq | |
| col 2 | NucDiff_v2.0 | name and current version of the tool |
| col 3 | SO:0000159 | Sequence Ontology accession number corresponding to the "deletion" SO term |
| col 4 | Del_st | |
| col 5 | Del_end | |
| col 6/col 7/col8 | . | score/strand/phase fields are not used |
| col 9, ID | "SNP_1" | ID in ref_snps.gff is equal to ID in query_snps.gff |
| col 9, Name | "deletion" | |
| col 9, del_len | Length(Deletion) | |
| col 9, query_dir | "1" or "-1" | -1 if the deleted fragment should be reverse complemented before its insertion to a Query_seq |
| col 9, query_sequence | Query_seq | |
| col 9, query_coord | Q_pos | |
| col 9, query_bases | "-" | |
| col 9, ref_bases | ATGC's |
An example with the deletion entries in query_struct.gff :
##gff-version 3
##sequence-region query_1 1 13000
query_1 NucDiff_v2.0 SO:0000159 5500 5500 . . . ID=SV_1;Name=deletion;del_len=88;query_dir=1;ref_sequence=ref_1;ref_coord=5726-5813;color=#0000EE
query_1 NucDiff_v2.0 SO:0000159 6500 6500 . . . ID=SV_2;Name=deletion;del_len=100;query_dir=1;ref_sequence=ref_1;ref_coord=6814-6913;color=#0000EE
query_1 NucDiff_v2.0 SO:0000159 7500 7500 . . . ID=SV_3;Name=deletion;del_len=150;query_dir=1;ref_sequence=ref_1;ref_coord=7914-8063;color=#0000EE
The query_struct.gff file contains the following information (see Figure 1 for notations):
| GFF3 fields | Content | Notes |
|---|---|---|
| col 1 | Query_seq | |
| col 2 | NucDiff_v2.0 | name and current version of the tool |
| col 3 | SO:0000159 | Sequence Ontology accession number corresponding to the "deletion" SO term |
| col 4 | Q_pos | |
| col 5 | Q_pos | |
| col 6/col 7/col8 | . | score/strand/phase fields are not used |
| col 9, ID | "SNP_1" | ID in query_snps.gff is equal to ID in ref_snps.gff |
| col 9, Name | "deletion" | |
| col 9, del_len | Length(Deletion) | |
| col 9, query_dir | "1" or "-1" | -1 if the deleted fragment should be reverse complemented before its insertion to a Query_seq |
| col 9, ref_sequence | Ref_seq | |
| col 9, ref_coord | Del_st - Del_end |
An example with the deletion entries in ref_struct.gff :
##gff-version 3
##sequence-region ref_1 1 15063
ref_1 NucDiff_v2.0 SO:0000159 5726 5813 . . . ID=SV_1;Name=deletion;del_len=88;query_dir=1;query_sequence=query_1;query_coord=5500;color=#0000EE
ref_1 NucDiff_v2.0 SO:0000159 6814 6913 . . . ID=SV_2;Name=deletion;del_len=100;query_dir=1;query_sequence=query_1;query_coord=6500;color=#0000EE
ref_1 NucDiff_v2.0 SO:0000159 7914 8063 . . . ID=SV_3;Name=deletion;del_len=150;query_dir=1;query_sequence=query_1;query_coord=7500;color=#0000EE
The ref_struct.gff file contains the following information (see Figure 1 for notations):
| GFF3 fields | Content | Notes |
|---|---|---|
| col 1 | Ref_seq | |
| col 2 | NucDiff_v2.0 | name and current version of the tool |
| col 3 | SO:0000159 | Sequence Ontology accession number corresponding to the "deletion" SO term |
| col 4 | Del_st | |
| col 5 | Del_end | |
| col 6/col 7/col8 | . | score/strand/phase fields are not used |
| col 9, ID | "SNP_1" | ID in ref_snps.gff is equal to ID in query_snps.gff |
| col 9, Name | "deletion" | |
| col 9, del_len | Length(Deletion) | |
| col 9, query_dir | "1" or "-1" | -1 if the deleted fragment should be reverse complemented before its insertion to a Query_seq |
| col 9, query_sequence | Query_seq | |
| col 9, query_coord | Q_pos |