release 0.0.20

y9c · Apr 23, 2024 · 4464db2 · 4464db2
1 parent ff7075f
commit 4464db2
Show file tree

Hide file tree

Showing 3 changed files with 13 additions and 3 deletions.
diff --git a/README.md b/README.md
@@ -36,7 +36,7 @@ CutSeq overcomes these limitations by enabling multiple operations in a automati
 
 ![](./docs/explain_library.png)
 
-# How to install?
+## How to install?
 
 ```bash
 pip install cutseq
@@ -53,3 +53,7 @@ cutseq -A TAKARAV3 test_R1.fq.gz test_R2.fq.gz
 Alternatively, you can specify a custom adapter sequence:
 
 `cutseq -a "ACACGACGCTCTTCCGATCTXXX<XXXXXXNNNNNNNNAGATCGGAAGAGCACACGTC"`
+
+## TODO
+
+- support more library scheme
diff --git a/cutseq/run.py b/cutseq/run.py
@@ -588,7 +588,13 @@ def main():
         type=str,
         help="Adapter sequence configuration.",
     )
-    parser.add_argument("-A", "--adapter-name", type=str, help="Built-in adapter name.")
+    parser.add_argument(
+        "-A",
+        "--adapter-name",
+        type=str.upper,
+        choices=BUILDIN_ADAPTERS.keys(),
+        help="Built-in adapter name.",
+    )
     parser.add_argument(
         "-O",
         "--output-prefix",

diff --git a/pyproject.toml b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.19"
+version = "0.0.20"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <[email protected]>"]
 license = "MIT"