release 0.0.18

y9c · Apr 23, 2024 · ef671b2 · ef671b2
1 parent 356addf
commit ef671b2
Show file tree

Hide file tree

Showing 2 changed files with 2 additions and 2 deletions.
diff --git a/cutseq/run.py b/cutseq/run.py
@@ -177,7 +177,7 @@ def __init__(self):
 
 
 BUILDIN_ADAPTERS = {
-    "INLINE": "CACGACGCTCTTCCGATCTNNNNN>NNNNN(ATCACG)AGATCGGAAGAGCACACGTC",
+    "INLINE": "AGTTCTACAGTCCGACGATCNNNNN>NNNNN(ATCACG)AGATCGGAAGAGCACACGTC",
     # Small RNA, double ligation method, without barcode
     # p5 - insert - p7
     # (Optional) trim 2nt on both end to increase quality

diff --git a/pyproject.toml b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.17"
+version = "0.0.18"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <[email protected]>"]
 license = "MIT"