Skip to content

Commit

Permalink
release 0.0.19
Browse files Browse the repository at this point in the history
  • Loading branch information
y9c committed Apr 23, 2024
1 parent cbff45f commit fe674ca
Show file tree
Hide file tree
Showing 2 changed files with 2 additions and 2 deletions.
2 changes: 1 addition & 1 deletion README.md
Original file line number Diff line number Diff line change
Expand Up @@ -52,4 +52,4 @@ cutseq -A TAKARAV3 test_R1.fq.gz test_R2.fq.gz

Alternatively, you can specify a custom adapter sequence:

`cutseq -a "ACACGACGCTCTTCCGATCTX<XXXAGATCGGAAGAGCACACGTC"`
`cutseq -a "ACACGACGCTCTTCCGATCTXXX<XXXXXXNNNNNNNNAGATCGGAAGAGCACACGTC"`
2 changes: 1 addition & 1 deletion pyproject.toml
Original file line number Diff line number Diff line change
@@ -1,6 +1,6 @@
[tool.poetry]
name = "cutseq"
version = "0.0.18"
version = "0.0.19"
description = "Automatically cut adapter / barcode / UMI from NGS data"
authors = ["Ye Chang <[email protected]>"]
license = "MIT"
Expand Down

0 comments on commit fe674ca

Please sign in to comment.